Review

human id panel (agena bioscience)

agena bioscience is a verified supplier

agena bioscience manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

agena bioscience human id panel
Human Id Panel, supplied by agena bioscience, used in various techniques. Bioz Stars score: 96/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human id panel/product/agena bioscience
Average 96 stars, based on 13 article reviews

human id panel - by Bioz Stars, 2026-06

96/100 stars

Images

Similar Products

human id panel (agena bioscience)

agena bioscience human id panel
Human Id Panel, supplied by agena bioscience, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human id panel/product/agena bioscience
Average 96 stars, based on 1 article reviews

human id panel - by Bioz Stars, 2026-06

96/100 stars

Buy from Supplier

xgen human id research panel (Integrated DNA Technologies)

Integrated DNA Technologies xgen human id research panel
Xgen Human Id Research Panel, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/xgen human id research panel/product/Integrated DNA Technologies
Average 95 stars, based on 1 article reviews

xgen human id research panel - by Bioz Stars, 2026-06

95/100 stars

Buy from Supplier

human treg phenotyping panel kit fluidigm (fluidigm)

fluidigm human treg phenotyping panel kit fluidigm
Human Treg Phenotyping Panel Kit Fluidigm, supplied by fluidigm, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human treg phenotyping panel kit fluidigm/product/fluidigm
Average 96 stars, based on 1 article reviews

human treg phenotyping panel kit fluidigm - by Bioz Stars, 2026-06

96/100 stars

Buy from Supplier

human β actin (Integrated DNA Technologies)

Integrated DNA Technologies human β actin
Human β Actin, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human β actin/product/Integrated DNA Technologies
Average 95 stars, based on 1 article reviews

human β actin - by Bioz Stars, 2026-06

95/100 stars

Buy from Supplier

xgen human exome research panel (Integrated DNA Technologies)

Integrated DNA Technologies xgen human exome research panel
Xgen Human Exome Research Panel, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/xgen human exome research panel/product/Integrated DNA Technologies
Average 95 stars, based on 1 article reviews

xgen human exome research panel - by Bioz Stars, 2026-06

95/100 stars

Buy from Supplier

human hif1α (Integrated DNA Technologies)

Integrated DNA Technologies human hif1α

(A) The migratory ability of melan-Ink4a-Arf−/− cells is significantly increased by 24 hr hypoxia exposure (***, P<0.0001). Representative images of migration wells for cells grown for 24 hr under normoxia (22% O2) and hypoxia (1% O2) are shown below the graph. (B) <t>HIF1α</t> protein is stabilized by 24 hr hypoxia, and HIF1α protein expression under hypoxia is eliminated by siHif1α treatment. Molecular weights: HIF1α=95 kDa, Tubulin = 50 kDa. (C) Hif1α mRNA levels are unchanged under hypoxia, consistent with HIF1α protein stabilization regulating signaling activity. Hif1α mRNA levels are significantly reduced by multiple siRNAs (**, P=0.0015). The mRNA expression levels of the known HIF1α target genes Kdm3a and Gapdh are significantly increased by 24 hr hypoxia (*, P<0.05), and are significantly downregulated with siHif1α KD under hypoxia, returning to near-normoxic levels (*, P<0.05). (D) 709 hypoxia-responsive genes were differentially expressed 1.5 fold under normoxia vs. hypoxia growth conditions. Ingenuity Pathway Analysis (IPA) predicted distinct upstream regulatory factors for upregulated and downregulated gene cohorts, listed at right. See Table S1 for the complete list of 709 hypoxia-responsive genes. (E) 712 HIF1α-dependent genes were differentially expressed 1.5-fold in both siHif1α KD RNAs as compared to non-silencing control. IPA predicted distinct upstream regulatory factors for upregulated and downregulated gene cohorts, listed at right. See Table S4 for the complete list of 712 HIF1α-dependent genes. Details of IPA analysis for predicted transcriptional regulators and downstream targets for the hypoxia-responsive genes and the HIF1α-dependent genes are in Tables S2 and S5, respectively. Norm = normoxia; Hpx = hypoxia; Ctr = control si; si1 and si6 = independent HIF1α-directed siRNA constructs.

Human Hif1α, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human hif1α/product/Integrated DNA Technologies
Average 95 stars, based on 1 article reviews

human hif1α - by Bioz Stars, 2026-06

95/100 stars

Buy from Supplier

human androgen receptor (Integrated DNA Technologies)

Integrated DNA Technologies human androgen receptor

Human Androgen Receptor, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human androgen receptor/product/Integrated DNA Technologies
Average 95 stars, based on 1 article reviews

human androgen receptor - by Bioz Stars, 2026-06

95/100 stars

Buy from Supplier

Image Search Results

Journal: Pigment cell & melanoma research

Article Title: Hypoxia-induced HIF1α targets in melanocytes reveal a molecular profile associated with poor melanoma prognosis

doi: 10.1111/pcmr.12579

Figure Lengend Snippet: (A) The migratory ability of melan-Ink4a-Arf−/− cells is significantly increased by 24 hr hypoxia exposure (***, P<0.0001). Representative images of migration wells for cells grown for 24 hr under normoxia (22% O2) and hypoxia (1% O2) are shown below the graph. (B) HIF1α protein is stabilized by 24 hr hypoxia, and HIF1α protein expression under hypoxia is eliminated by siHif1α treatment. Molecular weights: HIF1α=95 kDa, Tubulin = 50 kDa. (C) Hif1α mRNA levels are unchanged under hypoxia, consistent with HIF1α protein stabilization regulating signaling activity. Hif1α mRNA levels are significantly reduced by multiple siRNAs (**, P=0.0015). The mRNA expression levels of the known HIF1α target genes Kdm3a and Gapdh are significantly increased by 24 hr hypoxia (*, P<0.05), and are significantly downregulated with siHif1α KD under hypoxia, returning to near-normoxic levels (*, P<0.05). (D) 709 hypoxia-responsive genes were differentially expressed 1.5 fold under normoxia vs. hypoxia growth conditions. Ingenuity Pathway Analysis (IPA) predicted distinct upstream regulatory factors for upregulated and downregulated gene cohorts, listed at right. See Table S1 for the complete list of 709 hypoxia-responsive genes. (E) 712 HIF1α-dependent genes were differentially expressed 1.5-fold in both siHif1α KD RNAs as compared to non-silencing control. IPA predicted distinct upstream regulatory factors for upregulated and downregulated gene cohorts, listed at right. See Table S4 for the complete list of 712 HIF1α-dependent genes. Details of IPA analysis for predicted transcriptional regulators and downstream targets for the hypoxia-responsive genes and the HIF1α-dependent genes are in Tables S2 and S5, respectively. Norm = normoxia; Hpx = hypoxia; Ctr = control si; si1 and si6 = independent HIF1α-directed siRNA constructs.

Article Snippet: HIF1α dsRNA duplex oligonucleotides (HIF1α Dsi RNA duplex oligos) were as follows: for murine Hif1α , si6 - MMC.RNAI.N0104431.12.6, (GGACGAUGAACAUCAAGUCAGCAAC) and si1 -MMC.RNAI.N0104431.12.1 (AGACAAUAGCUUCGCAGAAUGCUCA); for Human HIF1α, si9- HSC.RNAi.N001530.12.9 (GCACUCAAUCAAGAAGUUGCAUUAA), si5- HSC.RNAi.N001530.12.5 (ACCAUAUAGAGAUACACAAAGUCGG) and si4 - HSC.RNAi.N001530.12.4 (GAUGGAAGCACUAGACAAAGUUCAC) (Integrated DNA technologies).

Techniques: Migration, Expressing, Activity Assay, Construct

A) Validation of significant HIF1α binding enrichment at proximal promoters of the known HIF1α target genes KDM6B and KDM3A in melanocytes as compared to IgG negative controls and a negative control genomic region on Chr 6 (***, P<0.0001). (B) Representative diagram showing that the HIF1α-ChIP bioreplicated peaks led to the identification of 591 genes with a HIF1α-ChIP peak located within +/− 5kb of their annotated TSSs. (C) Location of the 1773 replicated HIF1α-ChIP peaks with respect to RefSeq annotated gene structures. (D) Pathway enrichment analysis validates that the set of 591 genes with HIF1α-ChIP peaks located within +/− 5kb of TSSs are enriched for known HIF1α target genes. See Tables S8 and S9 for the complete lists of 1773 replicated HIF1α-ChIP peaks and 591 genes, respectively.

Journal: Pigment cell & melanoma research

Article Title: Hypoxia-induced HIF1α targets in melanocytes reveal a molecular profile associated with poor melanoma prognosis

doi: 10.1111/pcmr.12579

Figure Lengend Snippet: A) Validation of significant HIF1α binding enrichment at proximal promoters of the known HIF1α target genes KDM6B and KDM3A in melanocytes as compared to IgG negative controls and a negative control genomic region on Chr 6 (***, P<0.0001). (B) Representative diagram showing that the HIF1α-ChIP bioreplicated peaks led to the identification of 591 genes with a HIF1α-ChIP peak located within +/− 5kb of their annotated TSSs. (C) Location of the 1773 replicated HIF1α-ChIP peaks with respect to RefSeq annotated gene structures. (D) Pathway enrichment analysis validates that the set of 591 genes with HIF1α-ChIP peaks located within +/− 5kb of TSSs are enriched for known HIF1α target genes. See Tables S8 and S9 for the complete lists of 1773 replicated HIF1α-ChIP peaks and 591 genes, respectively.

Techniques: Binding Assay, Negative Control

A) Venn diagram illustrating the intersections of genes with HIF1α-ChIP peaks (light orange), HIF1α-dependent genes (purple), and hypoxia-responsive genes (red). (B) Quantitative gene expression for siHIF1α KD in 501mel cells under 24 hr hypoxia for four of the 81 HIF1α direct target genes verifies gene expression changes under siHIF1α KD (*, P<0.05; **, P<0.01; ***, P<0.001). HIF1α is included as a positive control. (C) Centrimo motif analysis for the 89 peaks within +/− 5kb of TSSs for the 81 HIF1α direct target genes finds that the top three enriched motifs (labeled 1, 2, and 3 in red, blue, and black, respectively) are consistent with the RCGTG HIF1α:ARNT consensus. (D) Consensus motif profiles near HIF1α-ChIP peak summits for the 89 peaks. Red, blue, and black line colors match the top 3 motifs shown in C. See Table S10 for the complete list of 81 HIF1α direct target genes.

Journal: Pigment cell & melanoma research

Article Title: Hypoxia-induced HIF1α targets in melanocytes reveal a molecular profile associated with poor melanoma prognosis

doi: 10.1111/pcmr.12579

Figure Lengend Snippet: A) Venn diagram illustrating the intersections of genes with HIF1α-ChIP peaks (light orange), HIF1α-dependent genes (purple), and hypoxia-responsive genes (red). (B) Quantitative gene expression for siHIF1α KD in 501mel cells under 24 hr hypoxia for four of the 81 HIF1α direct target genes verifies gene expression changes under siHIF1α KD (*, P<0.05; **, P<0.01; ***, P<0.001). HIF1α is included as a positive control. (C) Centrimo motif analysis for the 89 peaks within +/− 5kb of TSSs for the 81 HIF1α direct target genes finds that the top three enriched motifs (labeled 1, 2, and 3 in red, blue, and black, respectively) are consistent with the RCGTG HIF1α:ARNT consensus. (D) Consensus motif profiles near HIF1α-ChIP peak summits for the 89 peaks. Red, blue, and black line colors match the top 3 motifs shown in C. See Table S10 for the complete list of 81 HIF1α direct target genes.

Techniques: Expressing, Positive Control, Labeling

A–B) DFS plots (% Disease Free Status versus time in months) for primary melanoma tumor expression of the 10 HIF1α direct target genes with significant P-value correlating gene expression with increased severity of DFS. A) AGTRAP, PKM, and GAPDH show reduced expression (25% lowest expression tumors, blue) correlating with poor prognosis/shorter DFS time. B) DTWD1, SEH1L, ZNF292, DARS, GPC6, PPAT, and RLF show increased expression (25% highest expression tumors, red) correlating with poor prognosis/shorter DFS time. C) Table of the 10 HIF1α direct target genes with associated P-values and FDR values for individual correlation with DFS. D) ROC curve analysis for the set of DFS-associated HIF1α direct target genes demonstrating the degree to which this set of 10 genes is predictive of DFS.

Journal: Pigment cell & melanoma research

Article Title: Hypoxia-induced HIF1α targets in melanocytes reveal a molecular profile associated with poor melanoma prognosis

doi: 10.1111/pcmr.12579

Figure Lengend Snippet: A–B) DFS plots (% Disease Free Status versus time in months) for primary melanoma tumor expression of the 10 HIF1α direct target genes with significant P-value correlating gene expression with increased severity of DFS. A) AGTRAP, PKM, and GAPDH show reduced expression (25% lowest expression tumors, blue) correlating with poor prognosis/shorter DFS time. B) DTWD1, SEH1L, ZNF292, DARS, GPC6, PPAT, and RLF show increased expression (25% highest expression tumors, red) correlating with poor prognosis/shorter DFS time. C) Table of the 10 HIF1α direct target genes with associated P-values and FDR values for individual correlation with DFS. D) ROC curve analysis for the set of DFS-associated HIF1α direct target genes demonstrating the degree to which this set of 10 genes is predictive of DFS.

Techniques: Expressing

A) Quantitative PCR verifies that HIF1α binding is significantly enriched at the proximal promoters of the novel HIF1α target loci AGTRAP, DTWD1, and SEH1L (***, P<0.0001). B) Western blot shows that HIF1α is induced by hypoxia in 501mel melanoma cells, and this expression is reduced with multiple siHIF1α RNAs. N = normoxia; H = hypoxia; C = control siRNA. Molecular weights: HIF1α=95 kDa, Tubulin = 50 kDa. C) The DFS-associated, HIF1α direct target genes show significantly altered expression upon HIF1α KD in 501mel cells (*, P<0.05; **, P<0.01; ***, P<0.001). No detectable expression was observed for GPC6 in 501mel cells (data not shown). HIF1α and KDM3A were included as controls.

Journal: Pigment cell & melanoma research

Article Title: Hypoxia-induced HIF1α targets in melanocytes reveal a molecular profile associated with poor melanoma prognosis

doi: 10.1111/pcmr.12579

Figure Lengend Snippet: A) Quantitative PCR verifies that HIF1α binding is significantly enriched at the proximal promoters of the novel HIF1α target loci AGTRAP, DTWD1, and SEH1L (***, P<0.0001). B) Western blot shows that HIF1α is induced by hypoxia in 501mel melanoma cells, and this expression is reduced with multiple siHIF1α RNAs. N = normoxia; H = hypoxia; C = control siRNA. Molecular weights: HIF1α=95 kDa, Tubulin = 50 kDa. C) The DFS-associated, HIF1α direct target genes show significantly altered expression upon HIF1α KD in 501mel cells (*, P<0.05; **, P<0.01; ***, P<0.001). No detectable expression was observed for GPC6 in 501mel cells (data not shown). HIF1α and KDM3A were included as controls.

Techniques: Real-time Polymerase Chain Reaction, Binding Assay, Western Blot, Expressing

Hierarchical clustering of 88 primary tumors (rows) relative to expression levels of the ten DFS-associated, HIF1α direct target genes (columns) is shown by the dendrograms and associated blue/gray/red blocks. Columns to the right of the cluster analysis show both a tally and a horizontal bar equal to the number of times each tumor was present in the highest or lowest 25% of tumors based upon rank gene expression of the 10 DFS-associated, HIF1α direct target genes, as was used in the Figure 4 DFS plots. The horizontal blue bars correspond to longer time of DFS/good prognosis, and the horizontal red bars correspond to shorter time of DFS/poor prognosis.

Journal: Pigment cell & melanoma research

Article Title: Hypoxia-induced HIF1α targets in melanocytes reveal a molecular profile associated with poor melanoma prognosis

doi: 10.1111/pcmr.12579

Figure Lengend Snippet: Hierarchical clustering of 88 primary tumors (rows) relative to expression levels of the ten DFS-associated, HIF1α direct target genes (columns) is shown by the dendrograms and associated blue/gray/red blocks. Columns to the right of the cluster analysis show both a tally and a horizontal bar equal to the number of times each tumor was present in the highest or lowest 25% of tumors based upon rank gene expression of the 10 DFS-associated, HIF1α direct target genes, as was used in the Figure 4 DFS plots. The horizontal blue bars correspond to longer time of DFS/good prognosis, and the horizontal red bars correspond to shorter time of DFS/poor prognosis.

Techniques: Expressing